Association of variation in the CLDN1 gene with atopic dermatitis in a German case-control cohort.

For citation purposes: Stemmler S, Parwez Q, Petrasch-Parwez E, Epplen JT, Hoffjan S. Association of variation in the CLDN1 gene with atopic dermatitis in a German case-control cohort. OA Dermatology 2013 Oct 01;1(1):5.

Dermatopathology

S Stemmler1*, Q Parwez2, E Petrasch-Parwez3, JT Epplen1,4, S Hoffjan1*

Authors affiliations

(1) Department of Human Genetics, Ruhr-University, Bochum, Germany

(2) Private medical practice, Gladbeck, Germany

(3) Department of Neuroanatomy and Molecular Brain Research, Ruhr-University Bochum, Germany

(4) Witten/Herdecke University, Witten, Germany

* Corresponding author Email: susanne.stemmler@rub.de

Abstract

Introduction

Atopic dermatitis is a chronic inflammatory skin disorder caused by complex interaction of genetic and environmental factors. Mutations in the gene encoding filaggrin, a major structural protein in the epidermis, constitute the most significant known risk factor for Atopic dermatitis development so far, implying an impaired skin barrier function as a major pathogenic mechanism in Atopic dermatitis development. However, a reduced skin barrier function has been demonstrated in Atopic dermatitis patients irrespective of Filaggrin genotype, suggesting that other factors may also modulate skin barrier integrity. It was recently shown the expression of Claudin-1, a major tight junction protein in the granular layer, was reduced in the skin of Atopic dermatitis patients and that variation in the Claudin-1 gene was associated with Atopic dermatitis in two small American populations. For replication of these findings, we investigated the role of Claudin-1 variation in an independent German case-control cohort.

Materials and Methods

Six single nucleotide polymorphisms (SNPs) in the Claudin-1 gene, including rs16865373 that had shown association with Atopic dermatitis in the European American cohort, were genotyped in 451 unrelated Atopic dermatitis patients and 375 non-atopic controls by means of restriction enzyme digestion. Allele, genotype and haplotype frequencies were subsequently compared between cases and controls.

Results

In this analysis, none of the investigated Single nucleotide polymorphisms or haplotypes in the Claudin-1 gene showed a significant association with Atopic dermatitis.

Conclusion

Our results do not support a substantial role for Claudin-1 variation in Atopic dermatitis pathogenesis. Yet, additional studies in independent cohorts are needed to confirm these results.

Introduction

Atopic dermatitis (AD) is a chronic inflammatory skin disorder that presumably arises from complex interaction between genetic and environmental factors[1]. Additional to immune-mediated mechanisms, the importance of an intact skin barrier in the protection against AD has been highlighted by several findings over the recent years[2]. Most importantly, mutations in the gene encoding filaggrin (FLG), a major structural protein in the stratum corneum of the epidermis, have been identified as the most significant known risk factor for AD development so far[3]. The FLG gene is located in the epidermal differentiation complex (EDC) on chromosome 1q21 and mutations in FLG have consistently been associated with early-onset persistent AD in many populations[4]. However, FLG mutations explain ~30% of AD risk[3] and impaired skin barrier function has also been observed in patients who do not harbour FLG mutations[5], suggesting that additional genetic factors involved in skin integrity and barrier function may contribute to AD risk.

Tight junctions in the granular layer of the epidermis have been postulated to build a second mechanism of defence against exogenous substances and transepidermal water loss below the strateum corneum[6]. It was recently demonstrated that the expression of claudin-1, a major tight junction protein, was reduced in the skin of patients with AD[7]. Further, single nucleotide polymorphisms (SNPs) in the gene encoding claudin-1 (CLDN1, located on chromosome 3q28) were associated with AD in North American cohorts of both European and African American origin[7]. These results strongly implicated tight junction defects in the pathogenesis of AD; however, the analysed cohorts were very small (156 and 152 cases, respectively) and replication has not been reported yet. In order to further investigate the role of CLDN1 variation for AD pathogenesis, we evaluated six SNPs in the CLDN1 gene, including rs16865373 that showed association in the European American cohort, in a German AD case-control sample.

Materials and Methods

Subjects

The case-control cohort comprised 451 unrelated patients with AD who were recruited by a consultant specialist for AD (Q.P., Gladbeck, Germany). The diagnosis was based on the criteria developed by Hanifin and Rajka[8]. Mean age of the AD patients was 19 ± 15 years (median 11 years). 375 control samples were collected in the same private practice. The control subjects had no self-reported allergies or allergic symptoms and no first degree relatives with allergic diseases. They all underwent clinical examination in order to exclude symptoms of AD, asthma or allergic rhinitis. The controls were adults of at least 40 years of age with a mean age of 62 ± 11 years (median 63 years). All patients and controls were Germans of European ancestry. More details concerning the patient and control groups were described elsewhere[9]. Informed consent was obtained from all participants. The study was approved by the Ethics Committee of the Ruhr-University Bochum and the Declaration of Helsinki protocols were followed.

Genotyping

DNA of AD patients and controls was extracted according to a standard method[10]. A total of six SNPs in the CLDN1 gene were selected for genotyping, representing the haplotypic block structures according to HapMap (www.hapmap.org). For genotyping, we used polymerase chain reaction (PCR) followed by restriction enzyme digestion. PCR analysis was performed in a total volume of 10 μl, containing 40 ng DNA, 200 mmol of each dNTP, 1.5–3 mmol MgCl2, 5 pmol of each primer and 0.5 U Taq-DNA-polymerase (Genecraft, Münster, Germany). Thermal cycling was performed at the RoboCycler and Biometra T cycler (Stratagene, Heidelberg, Germany and Biometra GmbH, Göttingen, Germany, respectively). After two initial cycles at 6°C and 3°C above the annealing temperature, 28–32 cycles of 95°C (30 sec), annealing temperature (30 sec) and 72°C (30 sec) were run. The PCR product was subsequently digested with the respective restriction enzyme. The fragments were then separated on 2.5–3.5% agarose gels in 1xTBE buffer (30–60 min, 200 V) and visualised with ethidium bromide (0.5% [w/v]). Additional information for each SNP (e.g. primer sequences, PCR conditions) is summarised in Table 1.

Table 1 Primers, PCR conditions and restriction enzymes used for the evaluation of polymorphisms in the CLDN1 gene

Statistics

Comparison of genotype and allele frequencies between AD patients and controls was performed according to the χ2 method; p < 0.05 was considered to be significant. Bonferroni correction for multiple testing was performed. Deviations from Hardy-Weinberg equilibrium (HWE) were evaluated using the deFinetti program (www.ihg.gsf.de/cgi-bin/hw/hwa1.pl). Haplotype frequencies were estimated and tested for haplotypic association using Haploview 4.0[11]. Power analyses were performed with the Genetic Power Calculator (www.pngu.mhg.harvard.edu/~purcell/gpc/cc2.html).

Results

The genotypic distributions for all six SNPs were in accordance with HWE in patients and controls. We did not observe a significant association with AD for any of the investigated SNPs (Table 2). Haplotype analyses did not reveal significant association results either (Table 3).

Power estimates ranged between 99 (assuming a genotypic relative risk of two for heterozygotes and four for homozygotes and D’ = 0.9 between marker and causal variation) and 64% power considering less strong genetic effects (with genotype relative risks of 1.5/2.25 and D’ = 0.8).

Table 2 Genotype and allele frequencies of CLDN1 polymorphisms in patients with atopic dermatitis (AD) compared to people with no known history of AD (controls)
Table 3

Frequencies of CLDN1 haplotypes in patients with atopic dermatitis (AD) compared to people with no known history of AD (controls)

Discussion

To our knowledge, this is the first attempt to replicate association of AD with variation in the tight junction protein claudin-1 that was recently described in two small American populations[7]. However, in our German AD case-control cohort, we did not find association with any of the six SNPs in the CLDN1 gene chosen to represent the most important haploblocks. We also included rs16865373 which had shown association in the European American cohort[7] but could not replicate this finding. Thus, our results do not support a substantial role of this gene for AD pathogenesis.

Besides FLG loss-of-function mutations that constitute a major risk factor for AD beyond dispute[3], variations in other skin barrier genes additional to claudin-1 have been implicated in AD pathogenesis recently. For example, a large meta-analysis of GWAS data, including 5,606 AD patients and 20,565 controls from 16 population-based studies, identified genome-wide significant association with polymorphisms near the OVOL1 and ACTL9 genes, both involved in epidermal proliferation and differentiation[12]. Furthermore, a 24-bp deletion in the gene encoding small proline-rich protein 3 (SPRR3), located within the EDC, was shown to be associated with AD in cohorts from Germany, Poland and the Czech Republic[13]. Thus, complex genetic modifications in epidermal barrier functions may underlie AD pathogenesis. However, the latter association results also still await replication in independent cohorts. For CLDN1, we could not confirm the reported association with AD.

We are aware of the fact that the results presented here require replication in additional independent cohorts and that the statistical power is only moderate due to the comparatively small cohort sizes. Still, the same cohort has successfully been used to detect other associations with AD before, including association with FLG mutations[14]. In addition, power calculations revealed between 64 and 99% power to detect a significant association, dependent on the assumed genotypic relative risk. Therefore, we believe that we could not have missed a substantial effect of CLDN1 variation in the given cohort. Still, comprehensive evaluation of the tested as well as additional CLDN1 SNPs in independent populations is needed in order to elucidate the role of this gene for AD pathogenesis and open the way for novel therapeutic straegies[15,16].

Conclusion

We did not find association of CLDN1 SNPs with AD, suggesting that variation in other epidermal genes may contribute to the observed epidermal barrier dysfunction. Novel therapeutic strategies are already under scrutiny that aim at strengthening the epidermal barrier in order to modulate the disease course and the acquisition of additional allergic disorders. Therefore, a better understanding of the genetic factors involved in skin integrity and barrier function is warranted in order to establish the basis for a more personalised therapy in the future.

Acknowledgements

We thank M. Kallenbach and N. Wirkus for technical assistance and the patients for their cooperation in this study.

Abbreviations list

AD, Atopic dermatitis; CLDN1, Claudin-1; EDC, Epidermal differentiation complex; FLG, Filaggrin; HWE, Hardy-Weinberg equilibrium; n.s., Not significant; PCR, Polymerase chain reaction; SNPs, Single nucleotide polymorphisms; TBE, Tris-Borate-EDTA (pH 8.3).

Authors contribution

All authors contributed to the conception, design, and preparation of the manuscript, as well as read and approved the final manuscript.

A.M.E

All authors abide by the Association for Medical Ethics (AME) ethical rules of disclosure.

  • 1. Barnes KC . An update on the genetics of atopic dermatitis: scratching the surface in 2009. J Allergy Clin Immunol 2010 Jan;125(1):16-29.
  • 2. Boguniewicz M, Leung DY. Atopic dermatitis: a disease of altered skin barrier and immune dysregulation. Immunol Rev 2011 Jul;242(1):233-46.
  • 3. McAleer MA, Irvine AD. The multifunctional role of filaggrin in allergic skin disease. J Allergy Clin Immunol 2013 Feb;131(2):280-91.
  • 4. Hoffjan S, Stemmler S. On the role of the epidermal differentiation complex in ichthyosis vulgaris, atopic dermatitis and psoriasis. Br J Dermatol 2007 Sep;157(3):441-9.
  • 5. Jakasa I, Koster ES, Calkoen F, McLean WH, Campbell LE, Bos JD. Skin barrier function in healthy subjects and patients with atopic dermatitis in relation to filaggrin loss-of-function mutations. J Invest Dermatol 2011 Feb;131(2):540-2.
  • 6. Jensen JM, Proksch E. The skin’s barrier. G Ital Dermatol Venereol 2009 Dec;144(6):689-700.
  • 7. De Benedetto A, Rafaels NM, McGirt LY, Ivanov AI, Georas SN, Cheadle C. Tight junction defects in patients with atopic dermatitis. J Allergy Clin Immunol 2011 Mar;127(3):773-86.
  • 8. Hanifin JM, Rajka G. Diagnostic features of atopic dermatitis. Acta Derm Venereol 198092.
  • 9. Macaluso F, Nothnagel M, Parwez Q, Petrasch-Parwez E, Bechara FG, Epplen JT, Hoffjan S. Polymorphisms in NACHT-LRR (NLR) genes in atopic dermatitis. Exp Dermatol 2007 Aug;16(8):692-8.
  • 10. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988 Feb;16(3):1215.
  • 11. Barrett JC . Haploview: Visualization and analysis of SNP genotype data. Cold Spring Harb Protoc 2009 Oct;2009(10):.
  • 12. Paternoster L, Standl M, Chen CM, Ramasamy A, Bønnelykke K, Duijts L. Meta-analysis of genome-wide association studies identifies three new risk loci for atopic dermatitis. Nat Genet 2011 Dec;44(2):187-92.
  • 13. Marenholz I, Rivera VA, Esparza-Gordillo J, Bauerfeind A, Lee-Kirsch MA, Ciechanowicz A. Association screening in the Epidermal Differentiation Complex (EDC) identifies an SPRR3 repeat number variant as a risk factor for eczema. J Invest Dermatol 2011 Aug;131(8):1644-9.
  • 14. Stemmler S, Parwez Q, Petrasch-Parwez E, Epplen JT, Hoffjan S. Two common loss-of-function mutations within the filaggrin gene predispose for early onset of atopic dermatitis. J Invest Dermatol 2007 Mar;127(3):722-4.
  • 15. Heimall J, Spergel JM. Filaggrin mutations and atopy: consequences for future therapeutics. Expert Rev Clin Immunol 2012 Feb;8(2):189-97.
  • 16. Novak N, Simon D. Atopic dermatitis–from new pathophysiologic insights to individualized therapy. Allergy 2011 Jul;66(7):830-9.

Licensee to OAPL (UK) 2013. Creative Commons Attribution License (CC-BY)

Primers, PCR conditions and restriction enzymes used for the evaluation of polymorphisms in the CLDN1 gene
Polymorphism Primer sequences Restriction enzyme Annealing temperature (°C)
rs3732925 F: TGACTCAAATCATCCAGGAGTTCA
R: CACAAGCAAGGCGTAGGTAATG
MslI 56
rs3774017 F: CAGGACTTCTTTACACCAAAACCA
R: TTAGAAACCTCCACCTGCCAA
TaaI 57
rs746286 F: AGATCCAGTTAGTGCAGGGAGG
R: TTCTTTGTATTATGTTGCGCAGG
MboI 56
rs17429833 F: AACTCTCCGCCTTCTGCACCT
R: CACTCACTGCTCAGATTCAGCAA
BsaHI 56
rs6781278 F: AGAATCGAAGCATGAAAGAGTCCT
R: AATGGCTCAAACCCTAGTGCTG
ScaI 56
rs16865373 F: TTCTGGAAATTCTGTGATTGCTCC
R: TGGTTTCTGATTTCTCCAAAGTATCTG
MmcI 58

Genotype and allele frequencies of CLDN1 polymorphisms in patients with atopic dermatitis (AD) compared to people with no known history of AD (controls)
Polymorphism Genotypes Alleles AD patients
Numbers inside the brackets are percentage values (%)
Controls
Numbers inside the brackets are percentage values (%)
p-value pc-value*
rs3732925 T/T
T/C
C/C
417 (93.1)
31 (6.9)
0 (0.0)
296 (94.3)
18 (5.7)
0 (0.0)
0.51 n.s.
T
C
865 (96.5)
31 (3.5)
610 (97.1)
18 (2.9)
0.52 n.s.
rs3774017 G/G
G/A
A/A
1 (0.2)
38 (8.2)
423 (91.6)
2 (0.6)
18 (5.7)
298 (92.5)
0.18 n.s.
A
G
40 (4.3)
884 (95.7)
22 (3.5)
614 (96.5)
0.39 n.s.
rs746286 A/A
A/G
G/G
241 (53.4)
173 (38.4)
37 (8.2)
160 (50.1)
135 (42.6)
22 (6.9)
0.46 n.s.
A
G
655 (72.6)
247 (27.4)
455 (71.8)
179 (28.2)
0.71 n.s.
rs17429833 C/C
C/G
G/G
9 (2.5)
48 (13.4)
300 (84.0)
6 (2.0)
36 (12.3)
251 (85.7)
0.87 n.s.
C
G
66 (9.2)
648 (90.8)
48 (8.2)
538 (91.8)
0.50 n.s.
rs6781278 G/G
G/A
A/A
131 (28.2)
235 (50.5)
99 (21.3)
97 (30.2)
152 (47.4)
72 (22.4)
0.68 n.s.
T
C
497 (53.4)
433 (46.6)
346 (53.9)
296 (46.1)
0.86 n.s.
rs16865373 C/C
C/T
T/T
432 (94.1)
27 (5.9)
0 (0.0)
308 (93.6)
21 (6.4)
0 (0.0)
0.77 n.s.
C
T
891 (97.1)
27 (2.9)
637 (96.8)
21 (3.2)
0.78 n.s.

*p-value after Bonferroni correction


n.s. = not significant


Frequencies of CLDN1 haplotypes in patients with atopic dermatitis (AD) compared to people with no known history of AD (controls)

Haplotype Frequency in AD patients Frequency in controls p-value
121221 0.425 0.416 0.748
122211 0.267 0.270 0.919
121211 0.148 0.158 0.618
121111 0.094 0.067 0.090
211221 0.025 0.029 0.721
121212 0.022 0.030 0.399

Source: oapublishinglondon.com

Leave a Reply

ArabicChinese (Simplified)EnglishFrenchGermanItalianJapanesePortugueseRussianSpanish

[mc4wp_form id="449"]